View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_high_43 (Length: 313)
Name: NF18453_high_43
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 36 - 295
Target Start/End: Complemental strand, 39088205 - 39087968
Alignment:
| Q |
36 |
ttcacccttgttggtataggcagtgatgccttgcaaaatggaaagttatttgtggaggtgttttttgggtcacatgcaaaagggtcacgtgcttcactac |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088205 |
ttcacccttgttggtataggcagtgatgccttgcaaaatggaaagttatttgtggaggtgttttttgggtcacatgcaaaagggtcacgtgcttcactac |
39088106 |
T |
 |
| Q |
136 |
tcattaagagaaggagaaatgcaatggtgatgaggatcgaatccattttggaaagacaagaaaatgaatgtataggttttggttttggtgggttgacaag |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39088105 |
tcattaagagaaggagaaatacaatggtgatgaggatcgaatccattttggaaagacaagaaaatgaatgtat----------------------acaag |
39088028 |
T |
 |
| Q |
236 |
ttatggaatggatggaacaatttatataggtgtggcatgatgtttctaaagccactgttc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088027 |
ttatggaatggatggaacaatttatataggtgtggcatgatgtttctaaagccactgttc |
39087968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University