View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_high_65 (Length: 226)
Name: NF18453_high_65
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_high_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 8498850 - 8498642
Alignment:
| Q |
1 |
atctctattatatattatatggacaaagcatggggtctagcacttgatacttcttcatcttctccaattccaatatctcactctcacccttttttacctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8498850 |
atctctattatatattatatggacaaagcatggggtctagctcttgatacttcttcatcttctccaattccaatatctcactctcacccttttttacctt |
8498751 |
T |
|
| Q |
101 |
ctaaacaaccatcttctactcataccaacgatagaatgtttcctattctaggatttcctgtcaaccttacccgtaacaccaacggcgaagacggcggtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8498750 |
ctaaacaaccatcttctactcataccaacgatagaatgtttcctattctaggatttcctgtcaaccttacccgtaacaccaacggcgaagacgggggtga |
8498651 |
T |
|
| Q |
201 |
ccggaaaat |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
8498650 |
ccggaaaat |
8498642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University