View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_low_33 (Length: 398)
Name: NF18453_low_33
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 347; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 1 - 383
Target Start/End: Complemental strand, 41764545 - 41764163
Alignment:
| Q |
1 |
aactcagcacccttcctcatttctcccatcgtccctcatatacccaagccccacctcactaccacccgctgcccgccattcctttctcccctccttcgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41764545 |
aactcagcacccttcctcatttctcccatcgtcccccatactcccacgccccacctcactaccacccgctgcctgccattcctttctcccctccttcgtt |
41764446 |
T |
 |
| Q |
101 |
aacaaattaaaattattgtcggtgtcacaattaaatgtcaaccctaccttcttgccaatatccttaacatcatccaccgccgcttgatgttttccatgga |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41764445 |
aacaaattaaaattattgccggtgtcacaattaaatgtcaaccctaccttcttgccaatatccttaacatcatccaccgccgcttgatgctttccatgga |
41764346 |
T |
 |
| Q |
201 |
gaataacccaaatttcccaatcatgattgattgaagaatttgagtttttagaagactcagaagttgaagtacctgcttctttggagtgatttttaccttt |
300 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41764345 |
gaataacccaattttcacaatcatgattgattgaagaatttgagtttttagaagactcagaagttgaagtacctgcttctttggagtgatttttaccttt |
41764246 |
T |
 |
| Q |
301 |
gcgaaccttaatatgccttttctgttttttcaaaatatgaagaatttgtttacgatcaagttccgacattcgagctacctttt |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41764245 |
gcgaaccttaatatgccttttctgttttttcaaaatatgaagaatttgtttacgatcaagttccgacattcgagctacctttt |
41764163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University