View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_low_42 (Length: 360)
Name: NF18453_low_42
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 18 - 350
Target Start/End: Original strand, 38612557 - 38612889
Alignment:
| Q |
18 |
gaggaggcataggttgttttcatttgttctctctgtaaatgagatttgctgattacgttaatgacgtattggcgtaactatgcgattctaatttgtaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612557 |
gaggaggcataggttgttttcatttgttctctctgtaaatgagatttgctgattacgttaatgacgtattggcgtaactatgcgattctaatttgtaagc |
38612656 |
T |
 |
| Q |
118 |
aactcgttaatcatatgttatctttgtttttacatagaaattgaggtattcaattatgatctacaatggaagagtagcttgtgtgtttctttatgatttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612657 |
aactcgttaatcatatgttatctttgtttttacatagaaattgaggtattcaattatgatctacaatggaagagtagcttgtgtgtttctttatgatttc |
38612756 |
T |
 |
| Q |
218 |
ttgttttttgacctattaatgttgcaattgtttactaacttcagttttgcaaatatgggagtcgtgattatctgtgcaatttatcttttgacgcttctct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38612757 |
ttgttttttgacctattaatgttgcaattgtttactaacttcagttttgcaaatatggtagtcgtgattatctgtgcaatttatcttttgatgtttctct |
38612856 |
T |
 |
| Q |
318 |
cgaaaacaaatttagttagtgttagcccctttg |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38612857 |
cgaaaacaaatttagttagtgttagcccctttg |
38612889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University