View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_low_59 (Length: 249)
Name: NF18453_low_59
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 659727 - 659512
Alignment:
| Q |
18 |
gttttatttatttagttctcatcaatctctctaatttgccattacaaagttggcaatttctagtttgtagaacactctttcttctatcattttgcatatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
659727 |
gttttatttatttagttctcatcaatctctctaatttgccattacaaagttggcaatttctagtttgtagaatactctttcttctatcattttgcatatc |
659628 |
T |
 |
| Q |
118 |
tcatgcatataccatgaccaagtgatccgatgaatgaaatattcttcatttttagaaacattattggtatttggtaggagcaatgtttcatccaaaacac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
659627 |
tcatgcatataccatgaccaagtgatccgatgaatgaaatattcttcatttttagaaacattattggtatttggtaggagcaatgtttcatccaaaacac |
659528 |
T |
 |
| Q |
218 |
acgaagagagcatatt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
659527 |
acgaagagagcatatt |
659512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University