View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_low_60 (Length: 246)
Name: NF18453_low_60
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 45 - 239
Target Start/End: Complemental strand, 5696984 - 5696789
Alignment:
| Q |
45 |
cttggatcaagggtattgtcttggcaataactgcatcatgaaatatatgtaaatatattaaccnnnnnnnnnnnn-gaacaataaatatattaacctttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5696984 |
cttggatcaagggtattgtcttggcaataactgcatcatgaaatatatgtaaatatattaacctttttttttttttgaacaataaatatattaacctttt |
5696885 |
T |
|
| Q |
144 |
aattagtccaataatctaaatttaagagaggtgtaaaaccagacatagaaaatacccagaatttgtttttagtatgccagcatattcttcgacatc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
5696884 |
aattagtccaataatctaaatttaagagaggtgtaaaaccagacatagaaaatacccagaatttgtttttagtatgcctgcatattcttcaacatc |
5696789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 45 - 88
Target Start/End: Complemental strand, 5684814 - 5684771
Alignment:
| Q |
45 |
cttggatcaagggtattgtcttggcaataactgcatcatgaaat |
88 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5684814 |
cttggatcaagggtattgtctaggcaataactgcatcatgaaat |
5684771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University