View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_low_61 (Length: 242)
Name: NF18453_low_61
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 31957424 - 31957606
Alignment:
| Q |
19 |
cacaatctttgtaaggtgaaaaagaagaagcaacaaagtgtagctgtaagaaaaacgcacgactaaaattgctttggtgttgaatcaacaaccactcggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31957424 |
cacaatctttgtaaggtgaaaaagaagaagcaacaaagtgtagctgtaagaaaaacgcacaactaaaattgctttggtgttgaatcaacaaccactcggt |
31957523 |
T |
 |
| Q |
119 |
gaaagtgttctggacacattttagcttgatgaggttattggtgatattcaactttgtagaaagtaaattaggttagtttaggg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
31957524 |
gaaagtgttctggacacattttagcttgatgaggttattggtgatattgaactttgtagaaagtaaattagattagtttaggg |
31957606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University