View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_low_68 (Length: 237)
Name: NF18453_low_68
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_low_68 |
 |  |
|
| [»] scaffold0291 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0291 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 2 - 117
Target Start/End: Complemental strand, 5336 - 5221
Alignment:
| Q |
2 |
ccatccaagaatttctctatatacataaccatttcataaatggggaagatgaagtgtcatagtaaaaaatataaaatacatacttaataaacaacaagca |
101 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5336 |
ccatccaagaatttccgtacatacataaccatttcataaatggggaagatgaagtgtcatagtaaaaaatataaaatacataattaataaacaacaagca |
5237 |
T |
 |
| Q |
102 |
tattaactttaagaaa |
117 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5236 |
tattaactttaagaaa |
5221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 140 - 222
Target Start/End: Complemental strand, 5223 - 5133
Alignment:
| Q |
140 |
aaaggcccaacttttttgttaaagtattttccaagagaggctcactcactcac--------tcacatatctatggttaaaagagttcaatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5223 |
aaaggcccaacttttttgttaaagtattttccaagagaggctcactcactcactcactcactcacatatctatggttaaaagagttcaatc |
5133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University