View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18453_low_77 (Length: 201)
Name: NF18453_low_77
Description: NF18453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18453_low_77 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 33221017 - 33220830
Alignment:
| Q |
14 |
atatgcatatcatattatttattatttttacatcaatcttgttatttattcctcgatgttcttaatctttgccatgttcatattgctcatgttcatcatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33221017 |
atatgcatatcatattatttattatttttatatcaatcttgttatttattcctcgatgttcttaatctttgccatgttcatattgctcatgttcatcatc |
33220918 |
T |
|
| Q |
114 |
gacgcttaaaaataaaaatttgtttgatgttcagcatgtgtcaacatctgttactgatacaacacaacacagacacatatgattagat |
201 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33220917 |
gacacttaaaaataaaaatttgtttgatgttcagcatgtgtcaacatctgttactgatacaacacaacacagacacatgtgattagat |
33220830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University