View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18454_low_11 (Length: 316)
Name: NF18454_low_11
Description: NF18454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18454_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 45756490 - 45756657
Alignment:
| Q |
18 |
cttctgtctgttcttacccgccattataactctacttgcctctaatcaaaacactctctctttaatgtatgtttaatttaataatgaaatgagcacgtta |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45756490 |
cttcagtctgttcttacccgccattataactctacttgcctctaatcaaaacactctctctttaatgtatgtttaatttaataatgaaatgagcacgtta |
45756589 |
T |
 |
| Q |
118 |
tattttcacaagccatgatttcaatttataggcttccgtgttgtaaaaatggttggtagatggtatag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45756590 |
tattttcacaagccatgatttcaatttataggcttccgtgttgtaaaaatggttggtagatggtatag |
45756657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 301
Target Start/End: Original strand, 45756699 - 45756782
Alignment:
| Q |
227 |
ggtgaattaattatgaatagtgaagaatctg---------tggacgtgtggtaacataaagagctcaaatgtgagtgtaacaaa |
301 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45756699 |
ggtgaattaattatgaatagtaaagaatctgataaaggtgtggatgtgtggtaacataaagagctcaaatgtgagtataacaaa |
45756782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University