View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18454_low_13 (Length: 275)
Name: NF18454_low_13
Description: NF18454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18454_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 15556625 - 15556543
Alignment:
| Q |
1 |
gattgaagaaaaaattgacttgttattttacactagcaaactgatatggaaaaagtaatttcagagatcaaaggcacacaaac |
83 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15556625 |
gattgaagaaacaattgctttgttattttacactagcaaactgatatggaaaaagtaatttcagagatcaaaggcactcaaac |
15556543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University