View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18454_low_6 (Length: 413)
Name: NF18454_low_6
Description: NF18454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18454_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 1e-63; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 263 - 398
Target Start/End: Complemental strand, 37790712 - 37790578
Alignment:
| Q |
263 |
atagagttctttacaaatctactaacttacaaacataaagaggccaatagtataagctcaatcttattatctaacaattggttcagccaagtcatcgact |
362 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790712 |
atagagttcttta-aaatctactaacttacaaacataaagaggccaatagcataagctcaatcttattatctaacaattggttcagccaagtcatcgact |
37790614 |
T |
 |
| Q |
363 |
caagctatatcaatagggatgatgttggatctatgt |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790613 |
caagctatatcaatagggatgatgttggatctatgt |
37790578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 188 - 296
Target Start/End: Complemental strand, 37790827 - 37790716
Alignment:
| Q |
188 |
tatgtcttcaacgaggatttttcacgaacaca---ttattggcaataacttgacttcccaaattatccaaaagaaccaatagagttctttacaaatctac |
284 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37790827 |
tatgtcttcaacgaggatttttcacaaacacaatattattggcaataacttgacttcccaaattatccaaaagaaccaatagagttctttacaaatctac |
37790728 |
T |
 |
| Q |
285 |
taacttacaaac |
296 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37790727 |
taacttacaaac |
37790716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 37791006 - 37790970
Alignment:
| Q |
9 |
atcatcaaagacagaagcggggaatcaataatgcgag |
45 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
37791006 |
atcatcaaagacagaagcgaggaatcaatattgcgag |
37790970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University