View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18454_low_9 (Length: 327)
Name: NF18454_low_9
Description: NF18454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18454_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 8 - 309
Target Start/End: Complemental strand, 3337248 - 3336947
Alignment:
| Q |
8 |
catcacagatcataaaggcagactctataattttatttatgaaattctgttaaaatacttgagtcttgcatggtaacaagtgaaaggagagttagtactt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3337248 |
catcatagatcataaaggcagactctataattttatttatgaaattctgttaaaatacttgagtcttgcatggtaacaagtgaaaggagagttagtactt |
3337149 |
T |
|
| Q |
108 |
ttgtgtgtaagtttttgtcgtcaacggccaacatcttgaagatattatctacattatctttgcttatgtaagccttattaactagtattttccttcaaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3337148 |
ttgtgtgtaagtttttgtcgtcaacggccaacttcttgaagatattatctacattatctttgcttatgtaagccttattaactagtattttccttcaaaa |
3337049 |
T |
|
| Q |
208 |
atggcagtgtaaccaaagtttgatgtcatgttaatcacgattttcaagtaaatatactcgagattgcttccactcctcttaaaggattcaatccccctca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3337048 |
atggcagtgtaaccaaagtttgatgtcatgttaatcacgattttcaagtaaatatactcgagattgcttccactcctcttaaaggattcaatccccctca |
3336949 |
T |
|
| Q |
308 |
tt |
309 |
Q |
| |
|
|| |
|
|
| T |
3336948 |
tt |
3336947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University