View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18455_high_5 (Length: 298)

Name: NF18455_high_5
Description: NF18455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18455_high_5
NF18455_high_5
[»] chr7 (1 HSPs)
chr7 (197-283)||(33840540-33840626)


Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 197 - 283
Target Start/End: Complemental strand, 33840626 - 33840540
Alignment:
197 taaccgccacagtatgcaaccaccttaaaaactgtcgtcggttccttctgccatcaattgttacaagtgttaacggtagtgaaatgt 283  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
33840626 taaccgccacagtatgcaaccaccttaaaaactgtcgtcggtttcttctgccatcaattgttacaagtgttaacggtagtgaaatgt 33840540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University