View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18455_high_5 (Length: 298)
Name: NF18455_high_5
Description: NF18455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18455_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 197 - 283
Target Start/End: Complemental strand, 33840626 - 33840540
Alignment:
| Q |
197 |
taaccgccacagtatgcaaccaccttaaaaactgtcgtcggttccttctgccatcaattgttacaagtgttaacggtagtgaaatgt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33840626 |
taaccgccacagtatgcaaccaccttaaaaactgtcgtcggtttcttctgccatcaattgttacaagtgttaacggtagtgaaatgt |
33840540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University