View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18455_low_6 (Length: 249)

Name: NF18455_low_6
Description: NF18455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18455_low_6
NF18455_low_6
[»] chr5 (1 HSPs)
chr5 (80-230)||(16113031-16113181)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 80 - 230
Target Start/End: Original strand, 16113031 - 16113181
Alignment:
80 aaagactctttcagatgacaccaaaaaaccaagcctatgattgttatgtggctaagtggcttccatgtggaaattagaattattagggttagctgattat 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16113031 aaagactctttcagatgacaccaaaaaaccaagcctatgattgttatgtggctaagtggcttccatgtggaaattagaattattagggttagctgattat 16113130  T
180 aataaaataaattaatatctaaaatatactaactaattattcagtagcatg 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
16113131 aataaaataaattaatatctaaaatatactaactaattattcagtagcatg 16113181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University