View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18456_high_4 (Length: 382)

Name: NF18456_high_4
Description: NF18456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18456_high_4
NF18456_high_4
[»] chr7 (1 HSPs)
chr7 (17-128)||(42037068-42037179)
[»] chr5 (1 HSPs)
chr5 (129-199)||(35588986-35589056)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 9e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 42037179 - 42037068
Alignment:
17 atgttactctatttatctctcttcttcttatatattctcgtgattcctgctttgttttgtaaccgtttctgcatttggcacctctctctagcagctgaat 116  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
42037179 atgtcactctatttatctctcttcttcttatatattctcgtgattcctgctttgttttgtaaccgtttctgcatttggcacctctctctagcagctcaat 42037080  T
117 ggcgtctcactc 128  Q
    ||||||||||||    
42037079 ggcgtctcactc 42037068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 129 - 199
Target Start/End: Complemental strand, 35589056 - 35588986
Alignment:
129 tgttatcgactgaactagaatatctcacaattagttacaatttgctactgatccttgttgttctcatccta 199  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
35589056 tgttatcgactaaactagaatatctcacaattagttacaatttgctactggtccttgttgttctcatccta 35588986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University