View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18456_high_4 (Length: 382)
Name: NF18456_high_4
Description: NF18456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18456_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 9e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 42037179 - 42037068
Alignment:
| Q |
17 |
atgttactctatttatctctcttcttcttatatattctcgtgattcctgctttgttttgtaaccgtttctgcatttggcacctctctctagcagctgaat |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42037179 |
atgtcactctatttatctctcttcttcttatatattctcgtgattcctgctttgttttgtaaccgtttctgcatttggcacctctctctagcagctcaat |
42037080 |
T |
 |
| Q |
117 |
ggcgtctcactc |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42037079 |
ggcgtctcactc |
42037068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 129 - 199
Target Start/End: Complemental strand, 35589056 - 35588986
Alignment:
| Q |
129 |
tgttatcgactgaactagaatatctcacaattagttacaatttgctactgatccttgttgttctcatccta |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35589056 |
tgttatcgactaaactagaatatctcacaattagttacaatttgctactggtccttgttgttctcatccta |
35588986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University