View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18456_low_9 (Length: 269)
Name: NF18456_low_9
Description: NF18456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18456_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 69 - 252
Target Start/End: Complemental strand, 44954779 - 44954596
Alignment:
| Q |
69 |
tacatatttgagaataaaccgaaattaatccgtgtgttacataaataactaagttacatgaattgatcctggaagaaaggcgttaccttccctttgcctt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44954779 |
tacatatttgagaataaaccgaaattaatccgtgtgttacataaataactaagttacatgaattgatcctggaagaaaggcgttaccttccctttgcctt |
44954680 |
T |
|
| Q |
169 |
catgacttgccttttccttcatccctcttcacatcatggaagaggagattaccttactttggtcacatcatcatcttcattttc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44954679 |
catgacttgccttttccttcatccctcttcacatcatggaagaggagattaccttactttggtcacatcatcatcttcattttc |
44954596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University