View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18457_high_26 (Length: 253)
Name: NF18457_high_26
Description: NF18457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18457_high_26 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 7704860 - 7705098
Alignment:
| Q |
15 |
atgaatagagtttaattcattaatgtaatgggatgggtacgttgaattgttgatttaattacggatgtctcatgatcactaagtatcctacgacgatatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7704860 |
atgaatagagtttaattcattaatgtaatgggatgggtacgttgaattgttgatttaattagggatgtctcatgatccctaagtatcctacgacgatatt |
7704959 |
T |
|
| Q |
115 |
gttacgaattaggttttgttcattctattcccctgttcaaaggttttagtttcctttcattctatttcatctgaattcgatgatgaattcttttttgaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7704960 |
gttacgaattaggttttgttcattctattcccctgttcaaaggttttagtttcctttcattctatttcatctgaattcgatgatgaattcttttttgaaa |
7705059 |
T |
|
| Q |
215 |
ttttgcttatctatagttactttgctggacaacatcatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7705060 |
ttttgcttatctatagttactttgctggacaacatcatt |
7705098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University