View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18457_high_28 (Length: 243)
Name: NF18457_high_28
Description: NF18457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18457_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 1356662 - 1356863
Alignment:
| Q |
18 |
ggttctacccaattattattattattggtgcgtgtagatgatatccgattcagaccgtagagttgcctaacccctaaataaacaaacaaatgtgtgtctc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1356662 |
ggttctacccaattattattattattggtgcgtgtagatgatatccgattcagaccgcagacttgcctaacccctaaataaacaaacaaatgtgtgtctc |
1356761 |
T |
 |
| Q |
118 |
cttgacttactcgtgcacaatttagcggaataaattagtagatgcgcgtttcgcatgccactaccatccatttctatttcttccctataataatatgcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1356762 |
cttgacttactcgtgcacaatttagcggaataaattagtagatgcgcgtttcgcatgccactaccatccatttctatttcttccctataataatatgcca |
1356861 |
T |
 |
| Q |
218 |
tc |
219 |
Q |
| |
|
|| |
|
|
| T |
1356862 |
tc |
1356863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 243
Target Start/End: Original strand, 1356879 - 1356913
Alignment:
| Q |
209 |
aatatgccatctttttcatgtattgcagcaacaac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1356879 |
aatatgccatctttttcatgtattgcagcaacaac |
1356913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University