View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18457_high_31 (Length: 236)
Name: NF18457_high_31
Description: NF18457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18457_high_31 |
 | |
|
| [»] scaffold0100 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 36318750 - 36318550
Alignment:
| Q |
19 |
ataccaggatagtgcaaacttactgtgacgttggaatgtcaatcctttcagctattaattcctactgcttttgcagggccattgccaccatctcgtcgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36318750 |
ataccaggatagtgcaaacttactgtgacgttggaatgtcaatcctttcagctattaattcctactgcttttgcagggccattgccaccatctcgtcgga |
36318651 |
T |
|
| Q |
119 |
gatcactctttattttggcaatttcgatgattatgttttcttcaaaagcgtacaacattgtccctcttgtccatagtaccaaggaagtgcttacagagat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36318650 |
gatcactctttattttggcaatttcgatgattatgttttcttcaaaagcgtacaacattgtccctcttgtccatagtaccaaggaagtgcttacagagat |
36318551 |
T |
|
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
36318550 |
a |
36318550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 43860 - 43981
Alignment:
| Q |
97 |
ccattgccaccatctcgtcggagatcactctttattttggcaatttcgatgattatgttttcttcaaaagcgtacaaca---ttgtccctcttgtccata |
193 |
Q |
| |
|
|||||||||||||| ||| | |||||||| ||| |||||||| ||| |||||| |||||||||||||| | || | | ||||| |||||||||||| |
|
|
| T |
43860 |
ccattgccaccatcacgttgtagatcactgttttgtttggcaacttcaatgattgtgttttcttcaaaaacatatacaatgtttgtctctcttgtccata |
43959 |
T |
|
| Q |
194 |
gtaccaaggaagtgcttacaga |
215 |
Q |
| |
|
|| |||||| ||||||||||| |
|
|
| T |
43960 |
gtgccaaggctgtgcttacaga |
43981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University