View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18457_high_31 (Length: 236)

Name: NF18457_high_31
Description: NF18457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18457_high_31
NF18457_high_31
[»] chr7 (1 HSPs)
chr7 (19-219)||(36318550-36318750)
[»] scaffold0100 (1 HSPs)
scaffold0100 (97-215)||(43860-43981)


Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 36318750 - 36318550
Alignment:
19 ataccaggatagtgcaaacttactgtgacgttggaatgtcaatcctttcagctattaattcctactgcttttgcagggccattgccaccatctcgtcgga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36318750 ataccaggatagtgcaaacttactgtgacgttggaatgtcaatcctttcagctattaattcctactgcttttgcagggccattgccaccatctcgtcgga 36318651  T
119 gatcactctttattttggcaatttcgatgattatgttttcttcaaaagcgtacaacattgtccctcttgtccatagtaccaaggaagtgcttacagagat 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36318650 gatcactctttattttggcaatttcgatgattatgttttcttcaaaagcgtacaacattgtccctcttgtccatagtaccaaggaagtgcttacagagat 36318551  T
219 a 219  Q
    |    
36318550 a 36318550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0100 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0100
Description:

Target: scaffold0100; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 43860 - 43981
Alignment:
97 ccattgccaccatctcgtcggagatcactctttattttggcaatttcgatgattatgttttcttcaaaagcgtacaaca---ttgtccctcttgtccata 193  Q
    |||||||||||||| ||| | |||||||| |||  |||||||| ||| |||||| |||||||||||||| | || |  |   ||||| ||||||||||||    
43860 ccattgccaccatcacgttgtagatcactgttttgtttggcaacttcaatgattgtgttttcttcaaaaacatatacaatgtttgtctctcttgtccata 43959  T
194 gtaccaaggaagtgcttacaga 215  Q
    || ||||||  |||||||||||    
43960 gtgccaaggctgtgcttacaga 43981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University