View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18457_high_33 (Length: 224)
Name: NF18457_high_33
Description: NF18457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18457_high_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 208
Target Start/End: Original strand, 35441505 - 35441699
Alignment:
| Q |
14 |
atgaagacaagattctaattagttgttgtgcctatggtgggattctaaacatatgctaaatccaaggttgagcttaaaatacaatgtgacatcattaatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35441505 |
atgaagacaagattctaattagttgttgtgcctatggtgggattcttaacatatgctaaatccaaggttgagcttaaaatacaacgtgacatcattaatc |
35441604 |
T |
|
| Q |
114 |
ctagctttccataacacaacttttgagttttcgtgtgaaataacactgtaaagaattaaagtattactatttcagtatgtagctggtctacatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35441605 |
ctagctttccataacacaacttttgagttttcgtgtgaaataacacggtaaagaattaaagtaacactatttcagtatgtagctggtctacatat |
35441699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University