View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18457_low_28 (Length: 254)
Name: NF18457_low_28
Description: NF18457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18457_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 53425777 - 53425547
Alignment:
| Q |
19 |
tgcatggcctcaaaagatttcaattcatccaactgtaacaggtgtgttgtgaataagatgtttttcatcgatctgaattgattatgattttgtaacaaaa |
118 |
Q |
| |
|
|||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425777 |
tgcatgacatcaaaagacttcaactcatccaactgtaacaggtgtgttgtgaataagatgtttttcatcgatctgaattgattatgattttgtaacaaaa |
53425678 |
T |
|
| Q |
119 |
tattacataaatttaaccaaaccctgctaatcaatatgtgattgatttgaatttctctctcacataaatcgagtcaagccaacctgttatatcctataca |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53425677 |
tattaaataaatttaaccaaaccctgctaatcaatatgtgattgatttgaatttctctctcacataaatcgagtcaagccaacctgttatatcccataca |
53425578 |
T |
|
| Q |
219 |
ttatttctatgtttacgctgatgatgtccat |
249 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |
|
|
| T |
53425577 |
ttatttctatgtttacgcttatgaggtccat |
53425547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 53434071 - 53434025
Alignment:
| Q |
15 |
cacatgcatggcctcaaaagatttcaattcatccaactgtaacaggt |
61 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53434071 |
cacatgcatggcctcaaaagatttcaactcatccaactgtaacaggt |
53434025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 26098777 - 26098735
Alignment:
| Q |
19 |
tgcatggcctcaaaagatttcaattcatccaactgtaacaggt |
61 |
Q |
| |
|
|||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26098777 |
tgcatgacatcaaaagatttcaactcatccaactgtaacaggt |
26098735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University