View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18457_low_30 (Length: 249)
Name: NF18457_low_30
Description: NF18457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18457_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 4 - 142
Target Start/End: Complemental strand, 44625075 - 44624937
Alignment:
| Q |
4 |
catttactaaattgacatcatccttaacatattccataccacctaaccactaatactaagtgtgtgtttggaaagttggctaactcttaaattaccgcgg |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44625075 |
catttactaaattgacatgatccttaacatatgtcataccacctaaccactaataccaagtgtgtgtttggaaagttggctaactcttaaattaccgcgg |
44624976 |
T |
|
| Q |
104 |
ttttataaaaacaaactagttatatgggtgcatttgatt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44624975 |
ttttataaaaacaaactagttatatgggtgcgtttgatt |
44624937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 97
Target Start/End: Complemental strand, 44630885 - 44630831
Alignment:
| Q |
43 |
cacctaaccactaatactaagtgtgtgtttggaaagttggctaactcttaaatta |
97 |
Q |
| |
|
|||||||| | ||||||||||||| ||||| |||||| ||| ||||||||||||| |
|
|
| T |
44630885 |
cacctaacaagtaatactaagtgtatgtttagaaagtcggccaactcttaaatta |
44630831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University