View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18458_high_14 (Length: 219)
Name: NF18458_high_14
Description: NF18458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18458_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 37188383 - 37188175
Alignment:
| Q |
1 |
gtaaaaatgattctaaaccattactaacaatttttggtttgaagtgaaagtcttctatatgattgacccttatgtcaagtcaattcta----------ac |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37188383 |
gtaaaaatgattctaaaccattactaacaatttttggtttgaagtgaaagtcttctatatgattgacccttatgtcaagtcaattctagacaattctaac |
37188284 |
T |
 |
| Q |
91 |
taacattggcaacctcatcttaatatctctcaattttgtgaacatttaatttaatcactggatgttaaattatatttactgatgtttattaaataatcat |
190 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37188283 |
taacattgccaacctcatcttaatatctctgaattgtgtgaacatttaatttaatcactggatgttaaattatatttactaatgtttattaaataatcat |
37188184 |
T |
 |
| Q |
191 |
ctagtttat |
199 |
Q |
| |
|
||||||||| |
|
|
| T |
37188183 |
ctagtttat |
37188175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University