View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18458_high_15 (Length: 218)
Name: NF18458_high_15
Description: NF18458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18458_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 143 - 205
Target Start/End: Complemental strand, 11844666 - 11844604
Alignment:
| Q |
143 |
ccaacggaatctcaacaaaatcttctcattatggactttgcagaaatagatgttgcacatggt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11844666 |
ccaacggaatctcaacaaaatcttctcattatggactttgcagaaatagatgttgcacatggt |
11844604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 11844824 - 11844715
Alignment:
| Q |
19 |
aaccagtagctgtttaattgaatcatcctattaatgatgacctgaagctaacttcagatgttcaacttttgtcgtcggacggatgggtattaggacatag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
11844824 |
aaccagtagctgtttaattgaatcatcctattaatgattacctgcagctaacttcaaatgctcaactttcgt-------cggatgggtattaggacatag |
11844732 |
T |
|
| Q |
119 |
atatcatagtgatgatt |
135 |
Q |
| |
|
|||||| ||| |||||| |
|
|
| T |
11844731 |
atatcacagttatgatt |
11844715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University