View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18458_high_15 (Length: 218)

Name: NF18458_high_15
Description: NF18458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18458_high_15
NF18458_high_15
[»] chr7 (2 HSPs)
chr7 (143-205)||(11844604-11844666)
chr7 (19-135)||(11844715-11844824)


Alignment Details
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 143 - 205
Target Start/End: Complemental strand, 11844666 - 11844604
Alignment:
143 ccaacggaatctcaacaaaatcttctcattatggactttgcagaaatagatgttgcacatggt 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11844666 ccaacggaatctcaacaaaatcttctcattatggactttgcagaaatagatgttgcacatggt 11844604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 11844824 - 11844715
Alignment:
19 aaccagtagctgtttaattgaatcatcctattaatgatgacctgaagctaacttcagatgttcaacttttgtcgtcggacggatgggtattaggacatag 118  Q
    |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||| |||||||| ||       |||||||||||||||||||||    
11844824 aaccagtagctgtttaattgaatcatcctattaatgattacctgcagctaacttcaaatgctcaactttcgt-------cggatgggtattaggacatag 11844732  T
119 atatcatagtgatgatt 135  Q
    |||||| ||| ||||||    
11844731 atatcacagttatgatt 11844715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University