View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18458_high_16 (Length: 208)

Name: NF18458_high_16
Description: NF18458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18458_high_16
NF18458_high_16
[»] chr4 (1 HSPs)
chr4 (12-208)||(30171140-30171338)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 30171338 - 30171140
Alignment:
12 gataatactatggtgaggaaatttagtcggtacagagtgacatgttttcaaatagatttcttttttattaaaaaatcaaacat--atatatttgtttgga 109  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    || |||||||||||  |||||||||||||||    
30171338 gataatactatggtgaggaaatttagtcggtaaagagtgacatgttttcaaatagatttcttttt----aagaaatcaaacatgtatatatttgtttgga 30171243  T
110 ---tatg-tcatatcgggagctattttgacgaaccagcatagaatttttgttgtggatataatacgttggaggagagcgaagagaagaagccacaatgga 205  Q
       |||  |||||||||||||||||||||||||||| | || | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
30171242 ctatataatcatatcgggagctattttgacgaaccaacttaaattttttgttgtggatataatacgtaggaggagagcgaagagaagaagccacaatgga 30171143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University