View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18458_low_11 (Length: 245)
Name: NF18458_low_11
Description: NF18458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18458_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 245
Target Start/End: Complemental strand, 54633018 - 54632787
Alignment:
| Q |
14 |
atcaaatgtttactcgaacaatttacatcagttaatttcaactccccttaggctgtatgtattacactagatccagcattttaggatttgttgttggtgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54633018 |
atcaaatgtttactcgaacaatttacatcagttaatttcaactccccttaggctgtatgtattacactagatccagcattttaggatttgttgttggtgt |
54632919 |
T |
|
| Q |
114 |
gacaatgtgacctaatcctcaagtgttaaactaattcagcattgttaccctgatcaagtagcaagtaggcaatgcagattgcagaacttatttgatcaaa |
213 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54632918 |
gacaacgtgacctaatcctcaagtgtaaaactaattcagcattgttaccctgatcaagtagcaagtaggcaatgcagattgcagaacttatttgatcaaa |
54632819 |
T |
|
| Q |
214 |
aacatagaaaacagaatggcagaggagataat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54632818 |
aacatagaaaacagaatggcagaggagataat |
54632787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 34 - 114
Target Start/End: Original strand, 45312701 - 45312781
Alignment:
| Q |
34 |
atttacatcagttaatttcaactccccttaggctgtatgtattacactagatccagcattttaggatttgttgttggtgtg |
114 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| | ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
45312701 |
atttagatcagttaatttcatctccccttaggctgtatgtattgccctagatccaacattttaggatttcttgttggtgtg |
45312781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University