View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18458_low_12 (Length: 245)
Name: NF18458_low_12
Description: NF18458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18458_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 3 - 110
Target Start/End: Complemental strand, 27254360 - 27254253
Alignment:
| Q |
3 |
gaacacaaatgaaacttgtcgtaacaggtcaaatgttccagatcaggtgatacaaatcaaatccatgatcgatatagttgacgaaatcactacaattata |
102 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27254360 |
gaacacaaatgaaacttgtcataacaggtcaaatgttccagatcaggtgatacaaatcaaatctatgatcgatatagttgatgaaatcactacaattata |
27254261 |
T |
 |
| Q |
103 |
tgttgata |
110 |
Q |
| |
|
|||||||| |
|
|
| T |
27254260 |
tgttgata |
27254253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 27247204 - 27247149
Alignment:
| Q |
104 |
gttgataaaggaagtatgaccaatctaatcaaattcactagtaatagtatacaatc |
159 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
27247204 |
gttgataaaggatgtatgaccgatctaatcaaattcactagtaagagtatacaatc |
27247149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 71
Target Start/End: Complemental strand, 27247242 - 27247208
Alignment:
| Q |
37 |
gttccagatcaggtgatacaaatcaaatccatgat |
71 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27247242 |
gttccagatcaggtgatacaaatcaaatctatgat |
27247208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University