View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18458_low_18 (Length: 208)
Name: NF18458_low_18
Description: NF18458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18458_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 30171338 - 30171140
Alignment:
| Q |
12 |
gataatactatggtgaggaaatttagtcggtacagagtgacatgttttcaaatagatttcttttttattaaaaaatcaaacat--atatatttgtttgga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
| T |
30171338 |
gataatactatggtgaggaaatttagtcggtaaagagtgacatgttttcaaatagatttcttttt----aagaaatcaaacatgtatatatttgtttgga |
30171243 |
T |
|
| Q |
110 |
---tatg-tcatatcgggagctattttgacgaaccagcatagaatttttgttgtggatataatacgttggaggagagcgaagagaagaagccacaatgga |
205 |
Q |
| |
|
||| |||||||||||||||||||||||||||| | || | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30171242 |
ctatataatcatatcgggagctattttgacgaaccaacttaaattttttgttgtggatataatacgtaggaggagagcgaagagaagaagccacaatgga |
30171143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University