View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18459_high_17 (Length: 234)

Name: NF18459_high_17
Description: NF18459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18459_high_17
NF18459_high_17
[»] chr4 (1 HSPs)
chr4 (19-192)||(55930928-55931101)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 55930928 - 55931101
Alignment:
19 aatattggctgcttttgagtannnnnnnnattgcccccctttttcttctttgaatatttgtagcaataatctgagttctggaccatttgtttactgtacc 118  Q
    |||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55930928 aatattggctgcttttgagtattttttttattgcccccctttttcttctttgaatatttgtagcaataatctgagttctggaccatttgtttactgtacc 55931027  T
119 tatttgtttatgttaaatgacagtttactctttcgaagaaatgtgtgagaagatgcatgatatgaaactttgag 192  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55931028 tatgtgtttatgttaaatgacagtttactctttcgaagaaatgtgtgagaagatgcatgatatgaaactttgag 55931101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University