View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18459_low_12 (Length: 268)
Name: NF18459_low_12
Description: NF18459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18459_low_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 32767851 - 32768116
Alignment:
| Q |
1 |
gtagtgtgaatgaatttgaaagaaacagaaaaaacaaaccgcttttgtggttaggatcacaatcataaccgagttcttcagtttcataatcatcgagcaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32767851 |
gtagtgtgaatgaatttgaaa--aacagaaaaaacaaaccgcttttgtggttaggatcacaatcataaccgagttcttcagtttcataatcatcgagcaa |
32767948 |
T |
 |
| Q |
101 |
gcccaaattccggtcaggcttcatgctgagggataagaatgaactgtcatcatctatttcttcatcatcttcttgtacttgttgttgaagaagaaaaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32767949 |
gcccaaattccggtcaggcttcatgctgagggataagaatgaactgtcatcatctatttcttcatcatcttcttgtactttttgttgaagaagaaaaagc |
32768048 |
T |
 |
| Q |
201 |
tcttgtttggttggaaatgctttggagggagagtgtttggttcggcaacagagatgtggcgttgattc |
268 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32768049 |
tcttgtttggttgggaatgctttggagggagagtatttggttcggcaacagagatgtgacgttgattc |
32768116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University