View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18459_low_17 (Length: 234)
Name: NF18459_low_17
Description: NF18459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18459_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 55930928 - 55931101
Alignment:
| Q |
19 |
aatattggctgcttttgagtannnnnnnnattgcccccctttttcttctttgaatatttgtagcaataatctgagttctggaccatttgtttactgtacc |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55930928 |
aatattggctgcttttgagtattttttttattgcccccctttttcttctttgaatatttgtagcaataatctgagttctggaccatttgtttactgtacc |
55931027 |
T |
|
| Q |
119 |
tatttgtttatgttaaatgacagtttactctttcgaagaaatgtgtgagaagatgcatgatatgaaactttgag |
192 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55931028 |
tatgtgtttatgttaaatgacagtttactctttcgaagaaatgtgtgagaagatgcatgatatgaaactttgag |
55931101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University