View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1845_high_25 (Length: 244)
Name: NF1845_high_25
Description: NF1845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1845_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 21181708 - 21181485
Alignment:
| Q |
1 |
catttgttgagctatagatgatattatcgacatagacttgaacaatcaacaaatgagattcactagattttctgaaatgtgatgtttcaatttatcatct |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
21181708 |
catttgttgagccatagatgatattatcgacatagacttgaacgatcaacaaatgagattcactagattttctgaaaagtgatgtttcaatttgtcatct |
21181609 |
T |
 |
| Q |
101 |
tgaaaaacattttctttcaaaaaggaactcaatatctctcatatcaagcccttggtgcttgtttgagaccatatagagccttagtgagtttgaaaacatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
21181608 |
tgaaaaacattttctttcaaaaaggaactca--atctctcatatcaagcccttggtgcttgtttgagaccatatagaaccttagtgagtttgaaaatatg |
21181511 |
T |
 |
| Q |
201 |
atcattaggtttttcgttgttgatgaaac |
229 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
21181510 |
---attaggttttttgttgttgatgaaac |
21181485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 17156400 - 17156355
Alignment:
| Q |
157 |
gcttgtttgagaccatatagagccttagtgagtttgaaaacatgat |
202 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
17156400 |
gcttgtttgagaccatatagtgctttagtgagtttaaaaacatgat |
17156355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University