View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1845_high_26 (Length: 243)
Name: NF1845_high_26
Description: NF1845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1845_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 12 - 140
Target Start/End: Original strand, 30739187 - 30739315
Alignment:
| Q |
12 |
atcatcattcttagttcttatgtaaatcaatagccaactaaggagttagatactttgatttatattaaagtggcttagggtcaaggaattaatcttagcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30739187 |
atcatcattcttagttcttatgtaaatcaatagccaactaaggagttagatactttgatttatattaaagtggcttagggtcaaggaattaatcttagcc |
30739286 |
T |
 |
| Q |
112 |
taaaattgttgataggaacctcaattgca |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30739287 |
taaaattgttgataggaacctcaattgca |
30739315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 30739919 - 30739979
Alignment:
| Q |
157 |
ctcaattgctttttattgcttgcttggataaatattagtcgcatgatagggaccatgaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30739919 |
ctcaattgctttttattgcttgcttggataaatcttagtcgcatgatagggaccatgaaat |
30739979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University