View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1845_low_18 (Length: 279)
Name: NF1845_low_18
Description: NF1845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1845_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 52969638 - 52969883
Alignment:
| Q |
18 |
gctagcgggccatcttgtctcacatttgctatattttctcttgtattagactcttaacagatcttaattagtgtacatgtttcttgtagcatgcatcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52969638 |
gctagcgggccatcttgtctcacatttgctatctttcctcttatattagactcttaacatatcttaattagtgtacatgtttcttgtagcatgcatcaat |
52969737 |
T |
 |
| Q |
118 |
tatcaattgtatatcaagtgagggtaagaataatagttgtattaacaatggatttcaaccgcttaagtaaatggttataagtttgatccctttatgtata |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||| || |||||| ||||||||| |
|
|
| T |
52969738 |
tatcaattgtatattaagtgagggtaagaataataggtgtattaacaatggatttcaaccgcttaagtaaatgttcataaattcgatccc-ttatgtata |
52969836 |
T |
 |
| Q |
218 |
tggagaaaatttgattgaaagaaaagaatttattttatatgctacat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52969837 |
tggagaaaatttgattgaaagaaaagaatttattttatatgctacat |
52969883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University