View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1845_low_19 (Length: 254)
Name: NF1845_low_19
Description: NF1845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1845_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 252
Target Start/End: Original strand, 32730102 - 32730338
Alignment:
| Q |
16 |
atgaatatgctccccaatgatgaagcatcacttgaaaagtggcagagaaatagtatattgattataagaatggaagggtgatacaaatgggccagtaagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730102 |
atgaatatgctccccaatgatgaagcatcacttgaaaagtggcagataaatagtatattgattataagaatggaagggtgatacaaatgggccagtaagg |
32730201 |
T |
 |
| Q |
116 |
ttgagacagaggagttatactttatgccccacccacgagtactcttcttggctcaaaagtaaatcccatagccaatcacaattcttaaattaacgaatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32730202 |
ttgagacagaggagttatactttatgccccacccacgagtactcttcttggctcaaaagtaaatccaatagccaatcacaattcttaaattaacgaatct |
32730301 |
T |
 |
| Q |
216 |
aaagtcactgttattattttgggacacaacccccact |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32730302 |
aaagtcactgttattattttgggacacaacccccact |
32730338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University