View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1845_low_3 (Length: 519)
Name: NF1845_low_3
Description: NF1845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1845_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 5e-48; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 342 - 483
Target Start/End: Original strand, 21182181 - 21182322
Alignment:
| Q |
342 |
gagaagcttgctaaccacaaccacataatagataatgttgtttagtgaaactcttaacctttttagagacagatatggtcttcctatctatcattttcct |
441 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||| |||| |||||| |
|
|
| T |
21182181 |
gagaagcttgctaaccacgaccacataatagataatgttgtttagtgaaactcttaacttttttagagacaaatatgatcttcctatttatcgctttcct |
21182280 |
T |
|
| Q |
442 |
taggtctattttgatttgaggtgccaatctaattgggatctt |
483 |
Q |
| |
|
||||| |||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
21182281 |
taggtatatttttatttgaggtgccaacctagttgggatctt |
21182322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 244 - 329
Target Start/End: Original strand, 21182014 - 21182099
Alignment:
| Q |
244 |
caaattagcaggtcagcctataaacacgatccaagggtgaacaaacaaatactcctgaagatcctttttggaatattagaggtatt |
329 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21182014 |
caaattagcaggtcagcctataaacccgatccaagggtgaacaaacaaatactcctgaagatcctttttggaatattagaggtatt |
21182099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 9 - 74
Target Start/End: Original strand, 21181721 - 21181786
Alignment:
| Q |
9 |
aggaatttactgaccatatgcaaaaagcatttgaaatgaccatcattgtataagtaagatttataa |
74 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
21181721 |
aggaatttactgaccatatgcaaaatgaatttgaaatgagcatgattgtagaagtaagatttataa |
21181786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University