View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1845_low_36 (Length: 233)
Name: NF1845_low_36
Description: NF1845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1845_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 49158861 - 49158663
Alignment:
| Q |
17 |
caatattgttcatgactcacattctatttacgtttatcaaagttcttaactatggttgttttatggattcagagtgaaagcaaatgtgctcttgtttatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158861 |
caatattgttcatgactcacattctatttacatttatcaaagttcttaactatggttgttttatggattcagagtgaaagcaaatgtgctcttgtttatg |
49158762 |
T |
 |
| Q |
117 |
gtcaaatgaacgagccccctggtgctcgtgcccgcgttggtcttacaggattgactgttgctgaacatttccgtgatgctgaaggacaagatgtgcttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158761 |
gtcaaatgaacgagccccctggtgctcgtgcccgcgttggtcttacaggattgactgttgctgaacatttccgtgatgctgaaggacaagatgtgcttc |
49158663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 86 - 215
Target Start/End: Complemental strand, 49154728 - 49154599
Alignment:
| Q |
86 |
cagagtgaaagcaaatgtgctcttgtttatggtcaaatgaacgagccccctggtgctcgtgcccgcgttggtcttacaggattgactgttgctgaacatt |
185 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| || |||||||| ||| | ||||||||||| |||| |
|
|
| T |
49154728 |
cagagtgagagcaaatgtgctcttgtctacggtcaaatgaatgagccccctggtgctcgtgcccgtgtcggtcttactggacttactgttgctgagcatt |
49154629 |
T |
 |
| Q |
186 |
tccgtgatgctgaaggacaagatgtgcttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49154628 |
tccgtgatgctgaaggacaagatgtgcttc |
49154599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 145
Target Start/End: Original strand, 27960289 - 27960350
Alignment:
| Q |
84 |
ttcagagtgaaagcaaatgtgctcttgtttatggtcaaatgaacgagccccctggtgctcgt |
145 |
Q |
| |
|
|||||||| ||||||||||||| |||| | ||||||||| || || ||||||||||||||| |
|
|
| T |
27960289 |
ttcagagtcaaagcaaatgtgcgtttgtgtgtggtcaaataaatgacccccctggtgctcgt |
27960350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University