View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18460_low_11 (Length: 247)
Name: NF18460_low_11
Description: NF18460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18460_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 11099055 - 11099267
Alignment:
| Q |
16 |
gttttcatatgtccggccattttgcaacccctcgtccaccatggccccatcacttacggtgatcggcaaggaatccagagtttcgctagcatgcttatcc |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11099055 |
gttttcatatgtcccgccattttgcaacccctcgtccaccatggccccatcacttacgatgatcagcaaggaatccagagtttccctagcatgcttatcc |
11099154 |
T |
|
| Q |
116 |
tcaatcaataccttttgattcgtcagccttgggggttctccctatatagtttgcagtacctttggggtgagatattcgttagaaccatgaaacgtatctc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
11099155 |
tcaatcaataccttttgattcgtcagccttgggggtt-tccctatatagtttgcagtaccttt-gggtgagatattcgttagaaccatgaaacgtatccc |
11099252 |
T |
|
| Q |
216 |
gctacgtgctgcctt |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11099253 |
gctacgtgctgcctt |
11099267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University