View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18460_low_13 (Length: 242)
Name: NF18460_low_13
Description: NF18460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18460_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 42395416 - 42395627
Alignment:
| Q |
12 |
aagaacaccagcaataggaccagctgttgtgtataagtaacattgtgaagccttcaacactttctctccttcttgcataccaaaaatattcttgaaaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42395416 |
aagaacaccagcaataggaccagctgttgtgtataagtaacattgtgaagccttcaacactttctctccttcttgcataccaaaaatattcttgaaaatg |
42395515 |
T |
 |
| Q |
112 |
ttccctctcccaccttcttgtattatccttgcacccaaactcaacttacccttcagagtctctgatagtttaggacctagttttactgcaatgaatttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42395516 |
ttccctctcccaccttcttgtattatccttgcacccaaactcaacttacccttcagagtctctgatagtttaggacctagttttactgcaatgaatttat |
42395615 |
T |
 |
| Q |
212 |
atatacttgatt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42395616 |
atatacttgatt |
42395627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 29296100 - 29295916
Alignment:
| Q |
19 |
ccagcaataggaccagctgttgtgtataagtaacattgtgaagccttcaacactttctctccttcttgcataccaaaaatattcttgaaaatgttccctc |
118 |
Q |
| |
|
|||||||||||||||||||| || ||||| || || || ||||| ||||| | ||||||| | |||||||| |||||||||| |||||||||||| |||| |
|
|
| T |
29296100 |
ccagcaataggaccagctgtggtatataaatagcactgagaagctttcaagagtttctcttcctcttgcatcccaaaaatatgcttgaaaatgttacctc |
29296001 |
T |
 |
| Q |
119 |
tcccaccttcttgtattatccttgcacccaaactcaacttacccttcagagtctctgatagtttaggacctagttttactgcaat |
203 |
Q |
| |
|
| ||||||||||| || || | ||||| ||||| ||||||||||||| |||||| || | ||||||||||| ||| |||||||| |
|
|
| T |
29296000 |
ttccaccttcttgaataattttggcacctaaacttaacttacccttcaaagtctcagaaaatttaggacctaatttcactgcaat |
29295916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University