View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18461_high_5 (Length: 224)
Name: NF18461_high_5
Description: NF18461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18461_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 10487207 - 10487403
Alignment:
| Q |
17 |
aatatccactacatagatccgttcctgctgatgggggaggaacaccatcataccattttgtttatgctttaacatgggaattccgaatgcgcatacctat |
116 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
10487207 |
aatatacactacatagatccatccctgctgatgggggaggaacaccatcataccattttgttgatgctttaccatgggaatctcgaatgcacatacctat |
10487306 |
T |
|
| Q |
117 |
accgaagctcctttgctcctcaacaatggccacatcaacgttgcattttagatagtccgcattaggtggctgcttccgtgtctcttgttgttgttgg |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10487307 |
accgaagctcctttgctcctcaaaaatggacgcatcaacgttgcattttagatagtccgcattaggtggctgcttccgtgtctcttgttgttgttgg |
10487403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 99 - 189
Target Start/End: Complemental strand, 29542000 - 29541910
Alignment:
| Q |
99 |
ccgaatgcgcatacctataccgaagctcctttgctcctcaacaatggccacatcaacgttgcattttagatagtccgcattaggtggctgc |
189 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| |||||| |||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
29542000 |
ccgaatgcatatacctataccaaagctcctttgctcctcaaaaatggctgcatcaacgttacattttagatagtccgcgtcaggtggctgc |
29541910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 44 - 206
Target Start/End: Original strand, 19023561 - 19023732
Alignment:
| Q |
44 |
ctgatgggggaggaacaccatcataccattttgtttatgctttaa---------catgggaattccgaatgcgcatacctataccgaagctcctttgctc |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| ||||||| | ||||||| | ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
19023561 |
ctgatgggggagcaacaccatcatactattttgttgatgcttttataaaattaccatgggagtcgcgaatgcacatacctataccaaagctcctttgctc |
19023660 |
T |
|
| Q |
135 |
ctcaacaatggccacatcaacgttgcattttagatagtccgcattaggtggctgcttccgtgtctcttgttg |
206 |
Q |
| |
|
||||| |||||| |||||||||| |||||||||| || || | |||||||||| |||||| | |||||| |
|
|
| T |
19023661 |
ctcaaaaatggctgcatcaacgttacattttagatggttcgtgtcaggtggctgccaccgtgtttgttgttg |
19023732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University