View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18461_low_4 (Length: 255)
Name: NF18461_low_4
Description: NF18461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18461_low_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 255
Target Start/End: Original strand, 52592224 - 52592469
Alignment:
| Q |
10 |
attatactggtattgaaatggagggacagatgcattggaaggcagtagtgtcccgagcctaagagataactcttggcattgtatactttgctcatctaca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592224 |
attatactggtattgaaatggagggacagatacattggaaggcagtagtgtcccgagcctaagagataactcttggcattgtatactttgctcatctaca |
52592323 |
T |
|
| Q |
110 |
tgagagttgtaagcattggaatgctcatcaatggattgcatagtcactgtgtcgcctataggcgtgttaaacttgattccattttgttctgctacagatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592324 |
tgagagttgtaagcattggaatgctcatcaatggattgcatagtcactgtgtcgcctataggcatgttaaacttgattccattttgttctgctacagatt |
52592423 |
T |
|
| Q |
210 |
cattgtagtaattgtaaggtaacaaaggactcgaggtgaacatatc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592424 |
cattgtagtaattgtaaggtaacaaaggactcgaggtgaacatatc |
52592469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University