View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18461_low_7 (Length: 235)
Name: NF18461_low_7
Description: NF18461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18461_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 37445913 - 37445709
Alignment:
| Q |
12 |
tcatcaatattacgtgcattatattaaggcattcattttctcccactnnnnnnnnnnnnnnnngtaccatgcatgttttgtatatggaggcatttactga |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37445913 |
tcattaatattacgtgcattatattaaggcattcattatctcccactacacacacacacac--gtaccatgcatgttttgtatatggaggcatttactga |
37445816 |
T |
 |
| Q |
112 |
acaacattaatttggtattttatctcttctaattaatgtcaggataattatctgaagttgagagaaatatccaagcatacgctacccctcgggttgaaac |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37445815 |
acaacattaattttgtattttatctcttctaattaatgtcaggataattatctgaagttgagagaaatatcccagcatacgctacccctcgggttgaaac |
37445716 |
T |
 |
| Q |
212 |
tcacatt |
218 |
Q |
| |
|
||||||| |
|
|
| T |
37445715 |
tcacatt |
37445709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University