View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18462_high_13 (Length: 216)
Name: NF18462_high_13
Description: NF18462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18462_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 41 - 199
Target Start/End: Original strand, 30723113 - 30723271
Alignment:
| Q |
41 |
attaatattgataattgttcgtgtttgaaaatgcagaaaaatagttctaggaaaactgttatacaaatggagtctgttggttcaactcacaagaagcata |
140 |
Q |
| |
|
||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | | |||||||||| |
|
|
| T |
30723113 |
attaatattgatacttggtagtgtttgaaaatgcagaaaaatagttctaggaaaactgttaaacaaatggagtctgttggttcaagtaataagaagcata |
30723212 |
T |
|
| Q |
141 |
aggcaaaagaggatataatcaacaaactacctgaatcacttataactcacattctgtct |
199 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
30723213 |
aggcaaacgaggatataatcagcaatctacctgattcacttataacttacattctgtct |
30723271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 78 - 116
Target Start/End: Original strand, 30715072 - 30715110
Alignment:
| Q |
78 |
aaaatagttctaggaaaactgttatacaaatggagtctg |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30715072 |
aaaatagttctaggaaaactgctatacaaatggagtctg |
30715110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University