View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18462_high_6 (Length: 375)
Name: NF18462_high_6
Description: NF18462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18462_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 26355582 - 26355931
Alignment:
| Q |
19 |
ccctctcctccattattgtttcttcaaatggttgttcagtcatcatggctatgacactgttctgcaaaaagcttgaatctttactaagaaactgtgaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26355582 |
ccctctcctccattattgtttcttcaaatggttgttcattcatcatggctatgacactgttctgcaaaaagcttgaatctttactaagaaactgtgaaac |
26355681 |
T |
 |
| Q |
119 |
aaaatggtttgaagctagtattttgtaagaaaaatggttgcttagtgaaatggcaccttgtttggcacaaagaatgtagtacaacaacaccagagcatcc |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26355682 |
aaaatggtttgaag---gtattttgtaagaaaaatggttgcttagtgaaatggcaccttgtttggcacaaagaatgtagtacagcaacaccagagcatcc |
26355778 |
T |
 |
| Q |
219 |
ttgcatatgaagggagaatggtaagtcaaacacccaaattaccctttttcttgttgtaatgcgaaaatcccaaaccaaataagtggtcattttaaattat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26355779 |
ttgcatatgaagggagaatggtaagtcaaacacccaaattaccctttttttggttgtaatgcgaaaatcccaaaccaaataagtggtcattttaaattat |
26355878 |
T |
 |
| Q |
319 |
gttgaagggcattgttgtattttgcagcttggtatttctctcctttgcttctc |
371 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
26355879 |
gttgaagggcattgttgtatttggcagcttggtatttctgtcctttacttctc |
26355931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University