View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18462_low_10 (Length: 266)
Name: NF18462_low_10
Description: NF18462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18462_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 40080765 - 40081026
Alignment:
| Q |
1 |
cttgctactcagggaattgcacaacttctacttcatggcgccttggccttgatatcaccatcgtcatc------atcatcatctccaaactcacacacct |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||| |
|
|
| T |
40080765 |
cttgctactcagggaattgcacaacttcaactttgtggcgccttggccttgatatcaccatcatcatcgtcgtcatcatcatctccaaactcacacgcct |
40080864 |
T |
|
| Q |
95 |
cgtctt---cttcgatcctttccatcccgacactgtgactcttctgaggaggccttttcatcgcttccgcatccaattcaatgccatttccacctgatct |
191 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40080865 |
cgtcttcttcttcgatcctttccatcccgaccctgtgactcttctgaggaggctttttcattgcttccgcatccaactcaacaccatttccacctgatct |
40080964 |
T |
|
| Q |
192 |
ggccctaagcgacgcagcagttacgagctcatgaaaatcatcatcgtttgtggtaggtgttg |
253 |
Q |
| |
|
| |||||||||||||||||||| ||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
40080965 |
gatcctaagcgacgcagcagttatgagttcattaaaatcatgatcgtttgtggtaggtgttg |
40081026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University