View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18462_low_7 (Length: 355)
Name: NF18462_low_7
Description: NF18462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18462_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 342
Target Start/End: Complemental strand, 1658983 - 1658666
Alignment:
| Q |
16 |
caaccattgtggttcagtcagttagaaattcttccctagtttcttggtctttaagtaactgatatgtattgtatagtaactcatatatatagagaagaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1658983 |
caaccattgtggttcagtcagttagaaattcttccctagtttcttggtctttaagtaactgatatgtattgtatagtaactcatatatatagagaaggaa |
1658884 |
T |
|
| Q |
116 |
atcaatgctctgacgcttgggtcaatgaagggctatgttttgctcgtctcaccatttagatnnnnnnnnttcccccttccattttacaaaattttgtaaa |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1658883 |
atcaatgctccgacgcttgggtcaatgaagggctatgttttgctcgtctcaccatttagat--aaaaaattcccccttccattttacaaaattttgtaaa |
1658786 |
T |
|
| Q |
216 |
ggacaaattagggatgcctaatttccgatttactaccttttaaagagg-tttttggtctatttccccctcctattttttctatctatattggtttaatct |
314 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| | |||| ||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1658785 |
ggacaaattagggatgcctaatttccggtttact--------atgaggtttttttgtctatgtccccctcctattttttctatctatattggtttaatct |
1658694 |
T |
|
| Q |
315 |
atatgttttgaggtagcatatctctgct |
342 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
1658693 |
atatgttttgaggtagcatatctttgct |
1658666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University