View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18464_high_10 (Length: 265)
Name: NF18464_high_10
Description: NF18464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18464_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 55070983 - 55071170
Alignment:
| Q |
19 |
gaccttttgttgagagaactgcttagaagatagtcagattacatagttatgaccaggcgccactcaaaagttttttggtatcttgaacgacgcgacattc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55070983 |
gaccttttgttgagagaactgcttagaagatagtcagattacatagttatgaccaggcgcctctcaaaagttttttggtatcttgaacgacgcgacattc |
55071082 |
T |
|
| Q |
119 |
caagatataaacttccttctcttgaagaaaccggcttcatatccttttaccacctggttagtgatgagattcttcagaaatgttgcag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55071083 |
caagatataaacttccttctcttgaagaaaccggcttcatatccttttaccacctggttagtgatgagattctttagaaatgttgcag |
55071170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 131 - 190
Target Start/End: Original strand, 55066785 - 55066844
Alignment:
| Q |
131 |
ttccttctcttgaagaaaccggcttcatatccttttaccacctggttagtgatgagattc |
190 |
Q |
| |
|
|||||||||||||||||||| | ||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
55066785 |
ttccttctcttgaagaaaccagattcttatgcttttaccacctggttggtgatgagattc |
55066844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 129 - 190
Target Start/End: Complemental strand, 49485324 - 49485263
Alignment:
| Q |
129 |
acttccttctcttgaagaaaccggcttcatatccttttaccacctggttagtgatgagattc |
190 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||| || ||| ||||| |||||||||||| |
|
|
| T |
49485324 |
acttccttctcttgaagaaactggcttcttatccttctatcacttggttggtgatgagattc |
49485263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University