View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18464_high_9 (Length: 276)
Name: NF18464_high_9
Description: NF18464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18464_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 13713400 - 13713126
Alignment:
| Q |
1 |
cagtcacattcgagttcgacgagggtagataatatcaacgactttcccggtgagatacagatactaactcaccttctctcttttcttcctacccgtgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13713400 |
cagtcacattcgagttcgacgagggtagataatatcaacgactttcccggtgagatac------taacccaccttctctcttttcttcctacccgtgaag |
13713307 |
T |
|
| Q |
101 |
ctttcagaatcaccgttctttccaagaggtggcacccc-ttgtcttactcactctccaatcctgtcatcgacgacagaagggtgcaaaactctgaggact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13713306 |
ctttcagaatcaccgttctttccaagaggtgacacccccttgtcttactcactctccgatcttgtcatcgacgacagaagggtgcaaaactcagaggact |
13713207 |
T |
|
| Q |
200 |
tgattcagtttcgtcaatttatagacgctgttatgt-----------tctcaccacctaaccctaaaatcttttcatctca |
269 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13713206 |
tgattcatttccgtcaatttatggacgctgttatgttctccacatactctcaccacctaaccctaaaatcttttcatctca |
13713126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 132
Target Start/End: Complemental strand, 19970643 - 19970572
Alignment:
| Q |
61 |
atactaactcaccttctctcttttcttcctacccgtgaagctttcagaatcaccgttctttccaagaggtgg |
132 |
Q |
| |
|
|||||||||||| |||||||||||||||| | | | || |||||||||| |||||| |||||||||| |||| |
|
|
| T |
19970643 |
atactaactcacattctctcttttcttccaatcagagacgctttcagaaccaccgtgctttccaagacgtgg |
19970572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University