View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18464_low_18 (Length: 238)
Name: NF18464_low_18
Description: NF18464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18464_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 8863450 - 8863672
Alignment:
| Q |
1 |
ggggatgattcatccaaacaatataattctattgctctcaagtcaaaggagaaatatatcaaaacatttcaa---gttgtagagtctgaataagacaatc |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8863450 |
ggggatgattcatccaaacaatatagttctattgctctcaagtcaaaggacaaatatatcaaaacatttcaacaagttgtagagtctgaataagacaatc |
8863549 |
T |
 |
| Q |
98 |
taggagaagattctttagaaggttctaatgaggatgaaatgatattctttattaagagactctaatatctgaacaagaaaaacaagtttcctgatagaaa |
197 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8863550 |
taggagaagattccataaaaggttctaatgaggatgaaatgacattctttatcaagagactctaatatctgaacaagaaaaacaagtttcctgatagaaa |
8863649 |
T |
 |
| Q |
198 |
caatgataccagaggatttaatt |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8863650 |
caatgataccagaggatttaatt |
8863672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 8869171 - 8869390
Alignment:
| Q |
1 |
ggggatgattcatccaaacaatataattctattgctctcaagtcaaaggagaaatatatcaaaacatttcaagttgtagagtctgaataagacaatctag |
100 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8869171 |
ggggatgattcatccaaacaatatagttatattgctctcaagtcaaaggacaaatatatcacaacatttcaagttgtagagtctgaataagacaatctag |
8869270 |
T |
 |
| Q |
101 |
gagaagattctttagaaggttctaatgaggatgaaatgatattctttattaagagactctaatatctgaacaagaaaaacaagtttcctgatagaaacaa |
200 |
Q |
| |
|
|||||||||| |||| ||||||||||| |||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8869271 |
gagaagattccgtagatggttctaatgaagatgaaatgacattctttatcaagagactctaacatctgaacaagaaaaacaagttttctgatagaaacaa |
8869370 |
T |
 |
| Q |
201 |
tgataccagaggatttaatt |
220 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
8869371 |
tgatgccagaggatttaatt |
8869390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University